This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
[[ $- = *i* ]] && source ~/bin/liquidprompt/liquidprompt | |
export LS_COLORS='rs=0:di=01;34:ln=01;36:mh=00:pi=40;33' | |
alias ls='ls --color=always' | |
export PATH="/home/ethollem/software/bpipe-0.9.10/bin:$PATH" | |
export PATH="~/bin:$PATH" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
CACGTCCTAAAAGTGACCAG | |
CACCCCCTGCTCCTGGCGCT | |
GGGTGGGCACGCTCCTCCCT | |
ATCACGCCCGGAGGAGGGCG | |
CTGGCCGCCCCCAGCCACCC | |
GGTCCCTGCAGAAGCGTGGC | |
GGAGGACGTGGCTGGGCTCG | |
GCAACTAGACGCAGCCCGCA | |
AGCCGCAGCCTTTGTGAACC | |
GAATAAAGCCCTTGAACCAG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>NG_007114.1:4986-6416 Homo sapiens insulin (INS), RefSeqGene on chromosome 11 | |
AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGT | |
GGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCG | |
TGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGC | |
CTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTG | |
GCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAG | |
CTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCT | |
GCAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTCCCAC | |
CCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAG | |
TTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import random | |
from argparse import ArgumentParser | |
from itertools import cycle | |
# Lol you actually clicked the link to read the figure assignment script, NERD! | |
LAB = ['Aidan', 'Ethan', 'Meghan', 'Stella', 'Talysa', 'Saloni', 'Tadas', 'Deana'] | |
random.shuffle(LAB) | |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/bin/bash | |
# Script for quickly setting up a new snakemake workflow | |
mkdir workflow | |
mkdir notes | |
mkdir resources | |
# Download license file | |
wget https://raw.githubusercontent.com/Illumina/licenses/master/gpl-3.0.txt | |
mv gpl-3.0.txt LICENSE |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python3 | |
from pathlib import Path | |
from Bio import SeqIO | |
from Bio.Seq import Seq | |
from argparse import ArgumentParser | |
FORMAT_DICT = { | |
".fa": "fasta", | |
".fasta": "fasta", | |
".gb": "genbank", |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python3 | |
from Bio import SeqIO | |
from argparse import ArgumentParser | |
import itertools | |
def get_args(): | |
parser = ArgumentParser() | |
parser.add_argument('genbank', nargs='+', default=[], help='List of genbank formated files.') | |
parser.add_argument('fasta', help='Output path to write fasta records to.') |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# a target rule to define the desired final output | |
rule all: | |
input: | |
"aggregated/a.txt", | |
"aggregated/b.txt" | |
# the checkpoint that shall trigger re-evaluation of the DAG | |
checkpoint somestep: | |
input: |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import sys | |
import subprocess | |
import os | |
import csv | |
from datetime import datetime | |
import re | |
import json | |
from pathlib import Path | |
IP_ADDRESS = '0.0.0.0' |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
HOME = (10, 12) | |
STOPS = {'Howard_Western': (0,0}, 'Howard_Ridge': (0,3), 'Howard_L': (0,9), | |
'Jarvis_Clark' : (2, 8), 'Jarvis_L': (2, 11), 'Touhy_Clark': (4,8), | |
'Touhy_Glenwood': (4, 13)} | |
# additional stops need to be added | |
BUSES = [((0,0), (11, 0)), ((0, 15), (11, 15)), ((0, 8), (11, 8)), | |
((7, 0), (7, 15)), ((10, 0), (10, 15))] |
NewerOlder